KIAA1261

Product ID	ORK02024
Accession No	AB033087
Description	transducin-like enhancer of split 4, transcript variant 3
Clone name	hh15855b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of KpnI site to SacI site of the vector.
cDNA sequence	DNA sequence (2754 bp) Predicted protein sequence (787 aa)
HaloTag ORF Clone	FHC02024
Flexi ORF Clone	FXC02024
Source	Human adult brain
Rouge ID	mKIAA1261 by Kazusa Mouse cDNA Project

Length: 2754 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	353 bp
Genome contig ID	gi89161216f_81277447
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ACTGACTAAATAAAGCTGTCTGCTCCTGCATTGAT
Flanking genome sequence (252787 - 252836)	----+--------+--------+--------+--------+----* AATGAAGGTGCGTTGTATTTGATACCCCTCCCCCCCTTTTTTTGGCAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	81377447	81530232	19	99.6	Perfect prediction

Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q04727	100.0	Transducin-like...	Homo sapiens
Q62441	99.6	Transducin-like...	Mus musculus
XP_001151633	99.7	hypothetical pr...	Pan troglodytes
BAE22372	99.5	unnamed protein...	Mus musculus
XP_001924253	99.4	similar to tran...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046767	8.1e-106	81.4	KIAA1547

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	629	662	PD000018	WD40 repeat
FPrintScan	IPR001680	606	620	PR00320	WD40 repeat
	IPR001680	648	662	PR00320	WD40 repeat
	IPR009146	686	708	PR01850	Groucho/transducin-like enhancer
	IPR009146	709	727	PR01850	Groucho/transducin-like enhancer
	IPR009146	728	747	PR01850	Groucho/transducin-like enhancer
	IPR001680	730	744	PR00320	WD40 repeat
	IPR009146	748	767	PR01850	Groucho/transducin-like enhancer
	IPR009146	768	787	PR01850	Groucho/transducin-like enhancer
HMMPfam	IPR005617	22	155	PF03920	Groucho/TLE
	IPR001680	492	528	PF00400	WD40 repeat
	IPR001680	548	575	PF00400	WD40 repeat
	IPR001680	581	619	PF00400	WD40 repeat
	IPR001680	623	661	PF00400	WD40 repeat
	IPR001680	705	743	PF00400	WD40 repeat
	IPR001680	756	784	PF00400	WD40 repeat
HMMSmart	IPR001680	491	528	SM00320	WD40 repeat
	IPR001680	534	575	SM00320	WD40 repeat
	IPR001680	580	619	SM00320	WD40 repeat
	IPR001680	622	661	SM00320	WD40 repeat
	IPR001680	664	702	SM00320	WD40 repeat
	IPR001680	704	743	SM00320	WD40 repeat
	IPR001680	744	784	SM00320	WD40 repeat
ProfileScan	IPR001680	497	670	PS50294	WD40 repeat
	IPR001680	587	628	PS50082	WD40 repeat
	IPR001680	629	670	PS50082	WD40 repeat
	IPR001680	711	742	PS50082	WD40 repeat
	IPR001680	711	787	PS50294	WD40 repeat
ScanRegExp	IPR001680	606	620	PS00678	WD40 repeat
ScanRegExp	IPR001680	648	662	PS00678	WD40 repeat

Primer_f	ATCCCCGCATCTAAAACCAAG
Primer_r	AGTAGACAGCTGAAGATTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATCCCCGCATCTAAAACCAAG
Primer_r	AGTAGACAGCTGAAGATTTGG
PCR product length	142 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles