Order Kazusa clone(s) from : ![]() |
Product ID | ORK02025 |
---|---|
Accession No | AB033096 |
Description | alanyl-tRNA synthetase 2, mitochondrial |
Clone name | hk06471 |
Vector information | |
cDNA sequence | DNA sequence (3970 bp) Predicted protein sequence (986 aa) |
HaloTag ORF Clone |
FHC02025
![]() |
Flexi ORF Clone | FXC02025 |
Source | Human adult brain |
Rouge ID |
mKIAA1270
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1009 bp |
---|---|
Genome contig ID | gi89161210r_44275370 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99902 - 99853) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 44375272 | 44389041 | 23 | 99.5 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002318 | 117 | 128 | PR00980 | Alanyl-tRNA synthetase |
IPR002318 | 239 | 250 | PR00980 | Alanyl-tRNA synthetase | |
IPR002318 | 266 | 279 | PR00980 | Alanyl-tRNA synthetase | |
IPR002318 | 323 | 339 | PR00980 | Alanyl-tRNA synthetase | |
IPR002318 | 347 | 360 | PR00980 | Alanyl-tRNA synthetase | |
HMMPfam | IPR002318 | 42 | 625 | PF01411 | Alanyl-tRNA synthetase |
IPR012947 | 722 | 780 | PF07973 | Threonyl/alanyl tRNA synthetase | |
HMMTigr | IPR002318 | 42 | 966 | TIGR00344 | Alanyl-tRNA synthetase |
ProfileScan | IPR002318 | 38 | 793 | PS50860 | Alanyl-tRNA synthetase |
![]() |
Primer_f | GGGACCCACATGGACTAAAGG |
---|---|
Primer_r | TAGCCCATGTCTCCTTGTGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGACCCACATGGACTAAAGG |
Primer_r | TAGCCCATGTCTCCTTGTGTC |
PCR product length | 157 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |