KIAA1274

Gene/Protein Characteristic Table for KIAA1274

Order Kazusa clone(s) from :

Product ID	ORK00792
Accession No	AB033100
Description	phosphatase domain containing, paladin 1
Clone name	hk09836s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4569 bp) Predicted protein sequence (861 aa)
HaloTag ORF Clone	FHC00792
Flexi ORF Clone	FXC00792
Source	Human adult brain
Rouge ID	mKIAA1274 by Kazusa Mouse cDNA Project
Note	We replaced hk09836, former representative clones for KIAA1274 with hk09836s1. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 4569 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1719 bp
Genome contig ID	gi89161187f_71808583
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ACAGAGCTTTTAAGCATTAAAAACAGCTAAATGTG
Flanking genome sequence (189630 - 189679)	----+--------+--------+--------+--------+----* AGTGCACCTGGCTGCTAATATGTCTTTAGTGTCAGACAGACGTTCTAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	71908583	71998211	20	99.5	Terminal No-hit

Features of the protein sequence

Description

Length: 861 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_603024	84.7	similar to Pala...	Bos taurus
NP_001029300	82.4	paladin [Rattus...	Rattus norvegicus
AAI37696	81.3	X99384 protein ...	Mus musculus
BAC40433	81.3	unnamed protein...	Mus musculus
AAI44848	81.1	CDNA sequence X...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003595	267	389	SM00404	Protein-tyrosine phosphatase

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GGTCCCAGTGAGCCAAGCAAG
Primer_r	GTGCCATGTTTGCGTTGAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTGCCATGTTTGCGTTGAGCC
Primer_r	GGTCCCAGTGAGCCAAGCAAG
PCR product length	112 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp