KIAA1298

Product ID	ORK06991
Accession No	AB037719
Description	slingshot protein phosphatase 1
Clone name	fg04206
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5463 bp) Predicted protein sequence (738 aa)
Source	Human fetal brain
Rouge ID	mKIAA1298 by Kazusa Mouse cDNA Project

Length: 5463 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3191 bp
Genome contig ID	gi89161190r_107602702
PolyA signal sequence (TATAAA,-21)	+--------+--------+----*----+---- AGCTTGATACTCTTTATAAAAAACAGCTGAATCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTCTGCCTCACATTAATTCATGTGGCATGCCAAAAGTTAGACTGAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	107702702	107723083	5	99.2	Perfect prediction

Length: 738 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW97832	100.0	slingshot homol...	Homo sapiens
EAW97830	98.0	slingshot homol...	Homo sapiens
AAH62341	98.0	Slingshot homol...	Homo sapiens
Q8WYL5	98.0	Protein phospha...	Homo sapiens
BAB84114	97.8	hSSH-1L [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051512	6.9e-10	25.7	KIAA1725

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000340	23	135	PF00782	Protein-tyrosine phosphatase
HMMSmart	IPR000340	1	135	SM00195	Protein-tyrosine phosphatase
ProfileScan	IPR000340	12	137	PS50054	Protein-tyrosine phosphatase
ProfileScan	IPR000387	59	116	PS50056	Protein-tyrosine phosphatase

Primer_f	AATTGCTCAAGTGTCTGGCTC
Primer_r	AACAGGAAGCAGTAATCTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-