KIAA1299

Product ID	ORK01158
Accession No	AB037720
Description	SH2B adaptor protein 1, transcript variant 2
Clone name	fg04370
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6043 bp) Predicted protein sequence (730 aa)
HaloTag ORF Clone	FHC01158
Flexi ORF Clone	FXC01158
Source	Human fetal brain
Rouge ID	mKIAA1299 by Kazusa Mouse cDNA Project

Length: 6043 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	736 bp
Genome contig ID	gi51511732f_28682053
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGGAGAAGCATAAATAAATAAAAAGGTTTATCTCG
Flanking genome sequence (110972 - 111021)	----+--------+--------+--------+--------+----* GTTCTATCGTGATGGCTATGGCCATTGTTTGCTGTGGGGACTGGGGACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	28781626	28793023	9	100.0	Perfect prediction

Length: 730 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW52000	0	100.0	SH2-B homolog, ...	Homo sapiens
AAF73913	0	99.9	SH2-B beta sign...	Homo sapiens
BAF83021	0	99.7	unnamed protein...	Homo sapiens
XP_849871	9.8e-214	96.6	similar to SH2 ...	Canis lupus fam...
XP_001502284	5.4e-210	94.9	SH2B adaptor pr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	586	673	PD000093	SH2 motif
FPrintScan	IPR000980	586	600	PR00401	SH2 motif
	IPR000980	608	618	PR00401	SH2 motif
	IPR000980	620	631	PR00401	SH2 motif
	IPR000980	652	666	PR00401	SH2 motif
HMMPfam	IPR015012	83	141	PF08916	Phenylalanine zipper
	IPR001849	306	435	PF00169	Pleckstrin-like
	IPR000980	586	663	PF00017	SH2 motif
HMMSmart	IPR001849	306	437	SM00233	Pleckstrin-like
HMMSmart	IPR000980	584	669	SM00252	SH2 motif
ProfileScan	IPR000980	586	684	PS50001	SH2 motif

Primer_f	CCCAGGGCCATTAACAACCAG
Primer_r	AACAAGGGTCAGGAAGCATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCAGGGCCATTAACAACCAG
Primer_r	AACAAGGGTCAGGAAGCATGG
PCR product length	148 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles