KIAA1306

Product ID	ORK04438
Accession No	AB037727
Description	CASK interacting protein 1
Clone name	fh05845
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4832 bp) Predicted protein sequence (1154 aa)
Source	Human fetal brain
Rouge ID	mKIAA1306 by Kazusa Mouse cDNA Project

Length: 4832 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1367 bp
Genome contig ID	gi51511732r_2067185
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCGCTGCCGTCGGCTGTCAATAAACAGCAGGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGGTGCCTGGCTCACTTTTTGGGGGCACATGTGTTGGGGGAGATGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	2167185	2177078	12	100.0	Perfect prediction

Length: 1154 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW85543	100.0	CASK interactin...	Homo sapiens
Q8WXD9	100.0	Caskin-1; CASK-...	Homo sapiens
XP_001084114	97.1	similar to CASK...	Macaca mulatta
EAW85544	99.7	CASK interactin...	Homo sapiens
NP_542421	88.1	CASK interactin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032965	9.9e-14	36.7	KIAA1139

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011511	8	68	PF07653	Variant SH3
	IPR001660	193	256	PF00536	Sterile alpha motif SAM
	IPR001660	272	326	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001452	7	69	SM00326	Src homology-3
	IPR001660	192	258	SM00454	Sterile alpha motif SAM
	IPR001660	261	328	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001452	4	70	PS50002	Src homology-3
	IPR001660	195	258	PS50105	Sterile alpha motif SAM
	IPR001660	264	328	PS50105	Sterile alpha motif SAM

Primer_f	CCCCCTCCAAGAAGTACTGAC
Primer_r	ACAATCGCTGGTTTTCGGCAT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-