KIAA1139

Product ID	ORK04439
Accession No	AB032965
Description	CASK interacting protein 2
Clone name	hk00330
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4193 bp) Predicted protein sequence (1124 aa)
Source	Human adult brain
Rouge ID	mKIAA1139 by Kazusa Mouse cDNA Project

Length: 4193 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	818 bp
Genome contig ID	gi51511734r_70907938
PolyA signal sequence (AATGAA,-22)	+--------+--------+----*----+---- CCCAACTAACACCAATGAAAACACCATTCCACGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGGGCTGTGTGTTTGCCTCTGTGACATGGGGACCCCTGACCCTAGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	71007938	71014814	16	99.5	Perfect prediction

Length: 1124 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WXE0	100.0	Caskin-2.	Homo sapiens
NP_065804	99.9	cask-interactin...	Homo sapiens
BAG62095	99.9	unnamed protein...	Homo sapiens
BAH14307	99.8	unnamed protein...	Homo sapiens
XP_001097098	98.0	similar to cask...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037727	7.1e-14	36.9	KIAA1306
D86982	1.4e-06	28.9	KIAA0229

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	37	49	PR01415	Ankyrin
	IPR002110	155	167	PR01415	Ankyrin
	NULL	704	716	PR01217	NULL
	NULL	762	774	PR01217	NULL
	NULL	799	820	PR01217	NULL
	NULL	828	844	PR01217	NULL
	NULL	846	863	PR01217	NULL
	NULL	938	963	PR01217	NULL
HMMPfam	IPR002110	3	35	PF00023	Ankyrin
	IPR002110	36	68	PF00023	Ankyrin
	IPR002110	69	91	PF00023	Ankyrin
	IPR002110	110	142	PF00023	Ankyrin
	IPR002110	145	174	PF00023	Ankyrin
	IPR011511	207	267	PF07653	Variant SH3
	IPR001660	409	472	PF00536	Sterile alpha motif SAM
	IPR001660	478	542	PF00536	Sterile alpha motif SAM
HMMSmart	IPR002110	3	32	SM00248	Ankyrin
	IPR002110	36	65	SM00248	Ankyrin
	IPR002110	69	98	SM00248	Ankyrin
	IPR002110	110	139	SM00248	Ankyrin
	IPR002110	142	171	SM00248	Ankyrin
	IPR001452	206	268	SM00326	Src homology-3
	IPR001660	408	474	SM00454	Sterile alpha motif SAM
	IPR001660	477	544	SM00454	Sterile alpha motif SAM
ProfileScan	IPR002110	1	180	PS50297	Ankyrin
	IPR002110	3	35	PS50088	Ankyrin
	IPR002110	36	68	PS50088	Ankyrin
	IPR002110	110	142	PS50088	Ankyrin
	IPR002110	142	174	PS50088	Ankyrin
	IPR001452	203	269	PS50002	Src homology-3
	IPR001660	411	474	PS50105	Sterile alpha motif SAM
	IPR001660	480	544	PS50105	Sterile alpha motif SAM

Primer_f	CACTGTATGGCAAGACCGAGG
Primer_r	ATTGAGAGCAGTGGGATCGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CACTGTATGGCAAGACCGAGG
Primer_r	ATTGAGAGCAGTGGGATCGTG
PCR product length	221 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles