KIAA0229

Product ID	ORK01060
Accession No	D86982
Description	ankyrin repeat and sterile alpha motif domain containing 1A
Clone name	ha02570
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6335 bp) Predicted protein sequence (1180 aa)
HaloTag ORF Clone	FHC01060
Flexi ORF Clone	FXC01060
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0229 by Kazusa Mouse cDNA Project

Length: 6335 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2791 bp
Genome contig ID	gi89161210f_34865019
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGAACAGACTGAATTAATAAATGAGAAGCGACATG
Flanking genome sequence (302138 - 302187)	----+--------+--------+--------+--------+----* AACGCAGCCTTAATTCTTCTGAGTCTTTGAATTGGAAAGCGTCTTGATGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	34965019	35167155	24	99.5	Perfect prediction

Length: 1180 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_518420	99.6	ankyrin repeat ...	Pan troglodytes
EAX03804	100.0	ankyrin repeat ...	Homo sapiens
Q92625	99.9	Ankyrin repeat ...	Homo sapiens
XP_001111692	96.3	similar to anky...	Macaca mulatta
EAX03803	99.7	ankyrin repeat ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032965	3.3e-13	29.0	KIAA1139
AB002377	7e-08	37.4	KIAA0379
AB033049	1.1e-06	24.0	KIAA1223
AB023174	1.3e-06	25.8	KIAA0957
AB014597	2.2e-06	25.3	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	126	138	PR01415	Ankyrin
FPrintScan	IPR002110	138	150	PR01415	Ankyrin
HMMPfam	IPR002110	53	124	PF00023	Ankyrin
	IPR002110	125	157	PF00023	Ankyrin
	IPR002110	158	190	PF00023	Ankyrin
	IPR002110	194	226	PF00023	Ankyrin
	IPR002110	227	259	PF00023	Ankyrin
	IPR002110	260	292	PF00023	Ankyrin
	IPR002110	295	324	PF00023	Ankyrin
	IPR001660	740	806	PF00536	Sterile alpha motif SAM
	IPR001660	814	879	PF00536	Sterile alpha motif SAM
	IPR002110	895	910	PF00023	Ankyrin
	IPR006020	988	1114	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR002110	125	154	SM00248	Ankyrin
	IPR002110	158	187	SM00248	Ankyrin
	IPR002110	194	223	SM00248	Ankyrin
	IPR002110	227	256	SM00248	Ankyrin
	IPR002110	260	289	SM00248	Ankyrin
	IPR002110	292	321	SM00248	Ankyrin
	IPR001660	739	808	SM00454	Sterile alpha motif SAM
	IPR001660	813	881	SM00454	Sterile alpha motif SAM
	IPR006020	983	1117	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR002110	115	330	PS50297	Ankyrin
	IPR002110	125	157	PS50088	Ankyrin
	IPR002110	158	190	PS50088	Ankyrin
	IPR002110	194	226	PS50088	Ankyrin
	IPR002110	227	259	PS50088	Ankyrin
	IPR002110	260	292	PS50088	Ankyrin
	IPR002110	292	324	PS50088	Ankyrin
	IPR001660	745	808	PS50105	Sterile alpha motif SAM
	IPR001660	816	875	PS50105	Sterile alpha motif SAM
	IPR006020	988	1114	PS01179	Phosphotyrosine interaction region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTGCAACAACATAGACTGACC
Primer_r	TTCAGTCTGTTCTAAGTTGTG
PCR product length	109 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles