Order Kazusa clone(s) from : ![]() |
Product ID | ORK06582 |
---|---|
Accession No | AB037729 |
Description | ral guanine nucleotide dissociation stimulator |
Clone name | fh08652 |
Vector information | |
cDNA sequence | DNA sequence (5796 bp) Predicted protein sequence (745 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1308
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3558 bp |
---|---|
Genome contig ID | gi89161216r_134862929 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 134962929 | 134974046 | 12 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001895 | 179 | 393 | PF00617 | Guanine-nucleotide dissociation stimulator CDC25 |
HMMSmart | IPR001895 | 178 | 445 | SM00147 | Guanine-nucleotide dissociation stimulator CDC25 |
ProfileScan | IPR001895 | 182 | 444 | PS50009 | Guanine-nucleotide dissociation stimulator CDC25 |
ScanRegExp | IPR001895 | 360 | 390 | PS00720 | Guanine-nucleotide dissociation stimulator CDC25 |
![]() |
Primer_f | CTACAAAGAATGGTGACAGCT |
---|---|
Primer_r | GCACTGGTTCTTGACACTTTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |