KIAA1308

Product ID	ORK06582
Accession No	AB037729
Description	ral guanine nucleotide dissociation stimulator
Clone name	fh08652
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5796 bp) Predicted protein sequence (745 aa)
Source	Human fetal brain
Rouge ID	mKIAA1308 by Kazusa Mouse cDNA Project

Length: 5796 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3558 bp
Genome contig ID	gi89161216r_134862929
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTTGAATATTATATTAAAATCCTGTTTCTACTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTGGTCATTACAGTTTTGTTCTTTCATTACCTGTCTTAATTAAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	134962929	134974046	12	99.2	Perfect prediction

Length: 745 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW88039	0	100.0	ral guanine nuc...	Homo sapiens
EAW88041	0	100.0	ral guanine nuc...	Homo sapiens
BAB84940	1.5e-156	98.2	FLJ00185 protei...	Homo sapiens
EAW88037	1.5e-156	98.2	ral guanine nuc...	Homo sapiens
AAQ13414	1.5e-156	98.2	Ral guanine nuc...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023176	3.8e-27	53.6	KIAA0959

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001895	179	393	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR001895	178	445	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR001895	182	444	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001895	360	390	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Primer_f	CTACAAAGAATGGTGACAGCT
Primer_r	GCACTGGTTCTTGACACTTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-