KIAA0959

Product ID	ORK01616
Accession No	AB023176
Description	ral guanine nucleotide dissociation stimulator-like 1, transcript variant 4
Clone name	hj05718
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4703 bp) Predicted protein sequence (820 aa)
HaloTag ORF Clone	FHC01616
Flexi ORF Clone	FXC01616
Source	Human adult brain
Rouge ID	mKIAA0959 by Kazusa Mouse cDNA Project

Length: 4703 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2239 bp
Genome contig ID	gi89161185f_181940898
PolyA signal sequence (None)	+--------+--------+----*----+---- GGACTTGGCTGGCATGTGCTGCCAGACCCAAAGGG
Flanking genome sequence (223392 - 223441)	----+--------+--------+--------+--------+----* ATTGTATCTGGATTATTAACCAGGTGGGTTTTGGGTTCCAGTGTGTCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	182040898	182164288	18	100.0	Perfect prediction

Length: 820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NZL6	100.0	Ral guanine nuc...	Homo sapiens
AAG14400	99.9	RalGDS-like [Ho...	Homo sapiens
CAH73873	98.4	ral guanine nuc...	Homo sapiens
CAD97658	98.2	hypothetical pr...	Homo sapiens
AAG14401	98.3	RalGDS-like [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037729	2.8e-50	53.6	KIAA1308
AB002349	1.4e-08	29.8	KIAA0351
AB002311	2.5e-05	22.9	KIAA0313
AB020653	0.00058	26.7	KIAA0846

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000651	120	226	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	281	502	PF00617	Guanine-nucleotide dissociation stimulator CDC25
	IPR000159	700	787	PF00788	Ras-association
HMMSmart	IPR000651	116	248	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	280	554	SM00147	Guanine-nucleotide dissociation stimulator CDC25
	IPR000159	700	787	SM00314	Ras-association
ProfileScan	IPR000651	117	248	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	284	553	PS50009	Guanine-nucleotide dissociation stimulator CDC25
	IPR000159	700	787	PS50200	Ras-association
ScanRegExp	IPR001895	469	499	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Primer_f	CAGGTTGAAGTATATGTAGCC
Primer_r	ACACAGGATGAACACGGGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-