KIAA0846

Product ID	ORK00656
Accession No	AB020653
Description	RAS guanyl releasing protein 3 (calcium and DAG-regulated), transcript variant 3
Clone name	hk05386
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4204 bp) Predicted protein sequence (691 aa)
HaloTag ORF Clone	FHC00656
Flexi ORF Clone	FXC00656
Source	Human adult brain
Rouge ID	mKIAA0846 by Kazusa Mouse cDNA Project

Length: 4204 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1862 bp
Genome contig ID	gi89161199f_33492446
PolyA signal sequence (None)	+--------+--------+----*----+---- AATAAACATTGTACTGTTCTTTTGCTTCTCAAAGG
Flanking genome sequence (150732 - 150781)	----+--------+--------+--------+--------+----* AATTATTCACTTGCCACTTTGGTTATTTTTGAGTTTTCGTACATAGGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	33592446	33643176	17	99.6	Perfect prediction

Length: 691 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX00432	100.0	RAS guanyl rele...	Homo sapiens
Q8IV61	99.9	Ras guanyl-rele...	Homo sapiens
XP_001165459	99.9	RAS guanyl rele...	Pan troglodytes
BAF85672	99.6	unnamed protein...	Homo sapiens
XP_525730	99.7	RAS guanyl rele...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002349	8.8e-11	29.2	KIAA0351
D87467	2.3e-08	26.5	KIAA0277
AB028955	4e-08	47.7	KIAA1032
AB002311	2.5e-06	23.0	KIAA0313
AB023176	1.6e-05	27.0	KIAA0959

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	493	507	PR00008	Protein kinase C
	IPR002219	509	518	PR00008	Protein kinase C
	IPR002219	522	533	PR00008	Protein kinase C
	IPR002219	534	546	PR00008	Protein kinase C
HMMPfam	IPR000651	2	104	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	148	334	PF00617	Guanine-nucleotide dissociation stimulator CDC25
	IPR002048	425	453	PF00036	Calcium-binding EF-hand
	IPR002048	454	482	PF00036	Calcium-binding EF-hand
	IPR002219	496	548	PF00130	Protein kinase C
HMMSmart	IPR000651	4	127	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	150	386	SM00147	Guanine-nucleotide dissociation stimulator CDC25
	IPR002048	425	453	SM00054	Calcium-binding EF-hand
	IPR002048	454	482	SM00054	Calcium-binding EF-hand
	IPR002219	496	545	SM00109	Protein kinase C
ProfileScan	IPR000651	5	127	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	154	385	PS50009	Guanine-nucleotide dissociation stimulator CDC25
	IPR002048	421	456	PS50222	Calcium-binding EF-hand
	IPR002048	459	485	PS50222	Calcium-binding EF-hand
	IPR002219	495	545	PS50081	Protein kinase C
ScanRegExp	IPR002048	434	446	PS00018	Calcium-binding EF-hand
	IPR002048	463	475	PS00018	Calcium-binding EF-hand
	IPR002219	496	545	PS00479	Protein kinase C

Primer_f	GTGCCAACCAGATTTACAGAT
Primer_r	CACGTTCTCTTATTATCCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-