KIAA1332

Product ID	ORK05002
Accession No	AB037753
Description	F-box protein 42
Clone name	fh15405
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5788 bp) Predicted protein sequence (651 aa)
Source	Human fetal brain
Rouge ID	mKIAA1332 by Kazusa Mouse cDNA Project

Length: 5788 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3831 bp
Genome contig ID	gi89161185r_16345921
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCAATTTAACAAATAAAATGGACAATTGTCTTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTTTTATTAGCAAAAAAAGAAAAAGAAAAGAGGTCTGGCCGGGCGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	16445921	16514303	9	100.0	Perfect prediction

Length: 651 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6P3S6	100.0	F-box only prot...	Homo sapiens
BAG51542	99.8	unnamed protein...	Homo sapiens
AAH43410	99.8	F-box protein 4...	Homo sapiens
Q5RDA9	99.4	F-box only prot...	Pongo abelii
XP_001086461	99.4	F-box protein 4...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011498	52	102	PF07646	Kelch repeat type 2
	IPR006652	107	161	PF01344	Kelch repeat type 1
	IPR011498	165	211	PF07646	Kelch repeat type 2

Primer_f	TTCACAGGTTATACAGCAGAG
Primer_r	TCAAATCAATCCACAGACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-