KIAA1341

Product ID	ORK00807
Accession No	AB037762
Description	myelin expression factor 2, transcript variant 1
Clone name	fj00303
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4544 bp) Predicted protein sequence (620 aa)
HaloTag ORF Clone	FHC00807
Flexi ORF Clone	FXC00807
Source	Human fetal brain
Rouge ID	mKIAA1341 by Kazusa Mouse cDNA Project

Length: 4544 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2679 bp
Genome contig ID	gi51511731r_46119719
PolyA signal sequence (CATAAA,-26)	+--------+--------+----*----+---- TCATATGTGCATAAATAACACTAATATTTATCATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTGGGGGCTGTTCTGTGATCTATTACATGATTTTTGCTCTCTTTTTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	46219719	46257788	16	99.2	Perfect prediction

Length: 620 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001106720	4.6e-205	98.9	similar to myel...	Macaca mulatta
Q9P2K5	2.1e-200	100.0	Myelin expressi...	Homo sapiens
EAW77337	3.7e-200	99.8	myelin expressi...	Homo sapiens
XP_001165031	1.6e-193	97.3	myelin gene exp...	Pan troglodytes
XP_001918232	2.7e-178	89.4	similar to myel...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	122	193	PF00076	RNA recognition motif
	IPR000504	255	325	PF00076	RNA recognition motif
	IPR000504	545	614	PF00076	RNA recognition motif
HMMSmart	IPR000504	121	194	SM00360	RNA recognition motif
	IPR000504	254	326	SM00360	RNA recognition motif
	IPR000504	544	615	SM00360	RNA recognition motif
ProfileScan	IPR000504	120	198	PS50102	RNA recognition motif
	IPR000504	253	330	PS50102	RNA recognition motif
	IPR000504	543	619	PS50102	RNA recognition motif

Primer_f	AGAAATTCAGTCAGTGTGGTC
Primer_r	CATTACGATCCAAGCGAACAT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-