KIAA1351

Product ID	ORK01161
Accession No	AB037772
Description	WD repeat domain 11
Clone name	fj01021s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4548 bp) Predicted protein sequence (1243 aa)
HaloTag ORF Clone	FHC01161
Flexi ORF Clone	FXC01161
Source	Human fetal brain
Rouge ID	mKIAA1351 by Kazusa Mouse cDNA Project
Note	We replaced fj01021, former representative clones for KIAA1351 with fj01021s1. (2002/5/10)

Length: 4548 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	814 bp
Genome contig ID	gi89161187f_122500864
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTACAAACATGATAAATAAATTAAAAATTCCATCC
Flanking genome sequence (158163 - 158212)	----+--------+--------+--------+--------+----* AGGCCTTTGTGTTCTCTGCATTGCTGTGCATGAGGCCAGGTCATGAGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	122600864	122659025	29	99.6	Perfect prediction

Length: 1243 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_508077	100.0	bromodomain and...	Pan troglodytes
Q9BZH6	100.0	Bromodomain and...	Homo sapiens
EAW49365	99.9	bromodomain and...	Homo sapiens
BAG37593	99.8	unnamed protein...	Homo sapiens
EAW49364	99.4	bromodomain and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	70	118	PF00400	WD40 repeat
HMMPfam	IPR001680	730	755	PF00400	WD40 repeat
HMMSmart	IPR001680	69	118	SM00320	WD40 repeat
	IPR001680	121	164	SM00320	WD40 repeat
	IPR001680	572	615	SM00320	WD40 repeat
	IPR001680	716	755	SM00320	WD40 repeat
	IPR001680	757	797	SM00320	WD40 repeat
	IPR001680	800	841	SM00320	WD40 repeat
ScanRegExp	IPR001680	105	119	PS00678	WD40 repeat
	IPR001680	390	404	PS00678	WD40 repeat
	IPR001680	742	756	PS00678	WD40 repeat
	IPR001907	869	882	PS00382	Peptidase S14

Primer_f	CCACTACCTGCACAGCTTATC
Primer_r	TCACTTCCTGTAGATTAACCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-