Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06738 |
---|---|
Accession No | AB037777 |
Description | sodium channel, voltage gated, type III alpha subunit |
Clone name | fj01605 |
Vector information | |
cDNA sequence | DNA sequence (4183 bp) Predicted protein sequence (519 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2623 bp |
---|---|
Genome contig ID | gi89161199r_165552284 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 165652284 | 165659222 | 3 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001696 | 272 | 291 | PR00170 | Na+ channel |
IPR001696 | 307 | 320 | PR00170 | Na+ channel | |
HMMPfam | IPR005821 | 79 | 289 | PF00520 | Ion transport |
IPR000048 | 420 | 440 | PF00612 | IQ calmodulin-binding region | |
ProfileScan | IPR000048 | 419 | 448 | PS50096 | IQ calmodulin-binding region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 46 | VFDISIMILICLNMVTMMVETD | 67 | SECONDARY | 22 | 2 | 74 | TLVLSRINLVFIVLFTGEFVLKL | 96 | PRIMARY | 23 | 3 | 105 | TIGWNIFDFVVVILSIVGMFLAE | 127 | PRIMARY | 23 | 4 | 140 | RVIRLARIGRILRLIKGAKGIRT | 162 | SECONDARY | 23 | 5 | 167 | LMMSLPALFNIGLLLFLVMFIYA | 189 | PRIMARY | 23 | 6 | 268 | FFFVSYIIISFLVVVNMYIAVIL | 290 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CATTTCACTTATTGGCCTCTG |
---|---|
Primer_r | GTACTGCTTGGTGAATCATGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATTTCACTTATTGGCCTCTG |
Primer_r | GTACTGCTTGGTGAATCATGC |
PCR product length | 161 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |