KIAA1363

Product ID	ORK00815
Accession No	AB037784
Description	neutral cholesterol ester hydrolase 1
Clone name	fj02385
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4116 bp) Predicted protein sequence (430 aa)
HaloTag ORF Clone	FHC00815
Flexi ORF Clone	FXC00815
Source	Human fetal brain
Rouge ID	mKIAA1363 by Kazusa Mouse cDNA Project

Length: 4116 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2822 bp
Genome contig ID	gi89161205r_173731141
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAATCATGTTTGGAAATAAAATTGCTCCATCTGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGCTTTCATTTTCCCGTCTCATTTTCTGTTTCCCATTTGAAAACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	173831141	173911535	5	99.1	Perfect prediction

Length: 430 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH28734	1e-183	99.8	Arylacetamide d...	Homo sapiens
BAH14802	1.6e-183	99.5	unnamed protein...	Homo sapiens
EAW78462	2.6e-183	99.5	arylacetamide d...	Homo sapiens
AAH47588	3e-183	99.3	AADACL1 protein...	Homo sapiens
BAH13028	4.9e-183	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013094	131	404	PF07859	Alpha/beta hydrolase fold-3
ScanRegExp	IPR002168	207	219	PS01174	Lipolytic enzyme

Primer_f	TACTCATACCTACAGCTACAG
Primer_r	AATACTGCTCTGAACTCAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-