Gene/Protein Characteristic Table for KIAA1364
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05985
Accession No AB037785
Description microtubule associated monooxygenase, calponin and LIM domain containing 3
Clone name fj02442
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4261 bp)
Predicted protein sequence (811 aa)
Source Human fetal brain
Rouge ID mKIAA1364 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4261 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 22 r 16702717 16765490 18 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 811 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q7RTP6 0 100.0 Protein MICAL-3.
Homo sapiens
XP_543888 0 95.1 similar to Prot...
Canis lupus fam...
XP_001064549 0 92.4 similar to Prot...
Rattus norvegicus
XP_001374018 0 89.8 similar to LanC...
Monodelphis dom...
XP_416395 0 87.4 similar to MICA...
Gallus gallus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018293 4.6e-124 48.9 KIAA0750
AB008567 7e-12 43.4 KIAA0302
AB020710 1.1e-11 40.9 KIAA0903
AB051455 1.2e-07 28.9 KIAA1668
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001781 627 681 PD000094 Zinc finger
HMMPfam IPR001715 354 459 PF00307 Calponin-like actin-binding
IPR001781 627 686 PF00412 Zinc finger
HMMSmart IPR001715 355 454 SM00033 Calponin-like actin-binding
IPR001781 626 680 SM00132 Zinc finger
ProfileScan IPR001715 353 456 PS50021 Calponin-like actin-binding
IPR001781 625 687 PS50023 Zinc finger
ScanRegExp IPR001781 627 661 PS00478 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACCTCAGCCCTCATGTCAGAC
Primer_r CATCAGTGACAGCTTTGGAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name GeneBridge 4
Primer_f ACCTCAGCCCTCATGTCAGAC
Primer_r CATCAGTGACAGCTTTGGAAC
PCR product length 127 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp