Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05985 |
---|---|
Accession No | AB037785 |
Description | microtubule associated monooxygenase, calponin and LIM domain containing 3 |
Clone name | fj02442 |
Vector information | |
cDNA sequence | DNA sequence (4261 bp) Predicted protein sequence (811 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1364
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | r | 16702717 | 16765490 | 18 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001781 | 627 | 681 | PD000094 | Zinc finger |
HMMPfam | IPR001715 | 354 | 459 | PF00307 | Calponin-like actin-binding |
IPR001781 | 627 | 686 | PF00412 | Zinc finger | |
HMMSmart | IPR001715 | 355 | 454 | SM00033 | Calponin-like actin-binding |
IPR001781 | 626 | 680 | SM00132 | Zinc finger | |
ProfileScan | IPR001715 | 353 | 456 | PS50021 | Calponin-like actin-binding |
IPR001781 | 625 | 687 | PS50023 | Zinc finger | |
ScanRegExp | IPR001781 | 627 | 661 | PS00478 | Zinc finger |
RT-PCR-ELISA |
Primer_f | ACCTCAGCCCTCATGTCAGAC |
---|---|
Primer_r | CATCAGTGACAGCTTTGGAAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCTCAGCCCTCATGTCAGAC |
Primer_r | CATCAGTGACAGCTTTGGAAC |
PCR product length | 127 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |