KIAA0750

Product ID	ORK01117
Accession No	AB018293
Description	microtubule associated monooxygenase, calponin and LIM domain containing 2, transcript variant 1
Clone name	hk04329
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3885 bp) Predicted protein sequence (1125 aa)
HaloTag ORF Clone	FHC01117
Flexi ORF Clone	FXC01117
Source	Human adult brain
Rouge ID	mKIAA0750 by Kazusa Mouse cDNA Project

Length: 3885 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	246 bp
Genome contig ID	gi51511727f_11988734
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGTAAATGGAAATAAATATTGTTCTTTATAAAGCT
Flanking genome sequence (253179 - 253228)	----+--------+--------+--------+--------+----* CATTGTTTCCTCTCTTCTTTGCCGTGGAAGCTTCTAAAACCTCACACACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	12088734	12241911	28	99.8	Perfect prediction

Length: 1125 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94851	100.0	Protein MICAL-2.	Homo sapiens
XP_001096541	98.2	microtubule ass...	Macaca mulatta
XP_001097087	98.2	microtubule ass...	Macaca mulatta
XP_534061	92.3	similar to Prot...	Canis lupus fam...
XP_864179	92.3	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037785	4.6e-95	48.9	KIAA1364
AB020710	2.6e-08	29.0	KIAA0903
AB008567	3.2e-08	29.8	KIAA0302
AB051455	0.00045	29.5	KIAA1668

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	1003	1057	PD000094	Zinc finger
FPrintScan	IPR003042	89	111	PR00420	Aromatic-ring hydroxylase
FPrintScan	IPR003042	216	231	PR00420	Aromatic-ring hydroxylase
HMMPfam	IPR002938	87	125	PF01494	Monooxygenase
	IPR001715	518	623	PF00307	Calponin-like actin-binding
	IPR001781	1003	1062	PF00412	Zinc finger
HMMSmart	IPR001715	519	618	SM00033	Calponin-like actin-binding
HMMSmart	IPR001781	1002	1056	SM00132	Zinc finger
ProfileScan	IPR001715	517	620	PS50021	Calponin-like actin-binding
ProfileScan	IPR001781	1001	1063	PS50023	Zinc finger
ScanRegExp	IPR001781	1003	1037	PS00478	Zinc finger

Primer_f	TCCCACCGAAAGTTCTTGCGC
Primer_r	TAGAGCAGAAGTGTGTCAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-