KIAA1412

Product ID	ORK00828
Accession No	AB037833
Description	transmembrane protein 2, transcript variant 1
Clone name	ha04795
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5913 bp) Predicted protein sequence (1386 aa)
HaloTag ORF Clone	FHC00828
Flexi ORF Clone	FXC00828
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA1412 by Kazusa Mouse cDNA Project
Note	We replaced fh12778, former representative clones for KIAA1412 with ha04795. (2002/5/10)

Length: 5913 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1628 bp
Genome contig ID	gi89161216r_73388307
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GAGATCTTACCTATTAAATATATTATTGGATTATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTTCCTGAAGGTCATTAGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	73488307	73573213	24	99.7	Perfect prediction

Length: 1386 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UHN6	100.0	Transmembrane p...	Homo sapiens
XP_001141007	99.7	transmembrane p...	Pan troglodytes
XP_541287	91.8	similar to tran...	Canis lupus fam...
XP_593521	90.9	similar to tran...	Bos taurus
AAH76570	86.9	Transmembrane p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033025	2e-153	48.7	KIAA1199

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	86	FICFAITSFSFFIALAIILGISS	108	PRIMARY	23

Primer_f	GTGACAGCTTATAGTGAATGG
Primer_r	CTTGGTACATGGAATAGTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-