KIAA1432

Product ID	ORK05660
Accession No	AB037853
Description	RAB6A GEF complex partner 1
Clone name	fj02309
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4961 bp) Predicted protein sequence (796 aa)
HaloTag ORF Clone	FHC05660
Flexi ORF Clone	FXC05660
Source	Human fetal brain
Rouge ID	mKIAA1432 by Kazusa Mouse cDNA Project
Note	We replaced fj00670, former representative clones for KIAA1432 with fj02309. (2002/5/10)

Length: 4961 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2570 bp
Genome contig ID	gi89161216f_5647341
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TCTCCCCTTGGTAAAGGGCAATAAAACCATTACAC
Flanking genome sequence (119215 - 119264)	----+--------+--------+--------+--------+----* AAACTTTGGTTTATTCATCATCTCAGGTTAACAGCCACGAAAATCATCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	5747341	5766554	11	99.5	Internal No-hit

Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI44297	100.0	Unknown (protei...	Homo sapiens
Q4ADV7	100.0	Protein RIC1 ho...	Homo sapiens
XP_520477	99.6	hypothetical pr...	Pan troglodytes
XP_001108907	98.7	similar to CG90...	Macaca mulatta
XP_001492194	96.6	similar to Prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009771	104	377	PF07064	Protein of unknown function DUF1339

Primer_f	TGCTACCCTTCTATTCAACAC
Primer_r	ACTGGGATAAACTGATGCTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-