Gene/Protein Characteristic Table for KIAA1456
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00842
Accession No AB040889
Description KIAA1456
Clone name fh16084
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5759 bp)
Predicted protein sequence (421 aa)
Flexi ORF Clone FXC00842
Source Human fetal brain
Rouge ID mKIAA1456 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5759 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 4128 bp
Genome contig ID gi51511724f_12814476
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGGGAACCAACCACCAGACAAGCAGCTGCAGTCT
Flanking genome sequence
(113571 - 113620)
----+----*----+----*----+----*----+----*----+----*
AAGAAAAACAAATTAGGGCAGGCCTCAGCATCTCTTTCCTATTACATAGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 8 f 12914144 12928045 2 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 421 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH16633 1.5e-175 100.0 C8orf79 protein...
Homo sapiens
NP_065895 7.2e-174 99.0 hypothetical pr...
Homo sapiens
BAG10072 1e-158 100.0 C8orf79 protein...
synthetic construct
XP_540002 6.2e-141 80.2 similar to CG17...
Canis lupus fam...
XP_001487893 7.2e-141 82.7 similar to CG17...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013216 16 106 PF08241 Methyltransferase type 11
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGACCTAGCTGGAGTAATCTG
Primer_r TAAGACTCCTCCAATAAACCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 8
Experimental conditions
Panel name GeneBridge 4
Primer_f TGACCTAGCTGGAGTAATCTG
Primer_r TAAGACTCCTCCAATAAACCC
PCR product length 155 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp