KIAA1456

Gene/Protein Characteristic Table for KIAA1456

Order Kazusa clone(s) from :

Product ID	ORK00842
Accession No	AB040889
Description	KIAA1456
Clone name	fh16084
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5759 bp) Predicted protein sequence (421 aa)
HaloTag ORF Clone	FHC00842
Flexi ORF Clone	FXC00842
Source	Human fetal brain
Rouge ID	mKIAA1456 by Kazusa Mouse cDNA Project

Length: 5759 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4128 bp
Genome contig ID	gi51511724f_12814476
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGGGAACCAACCACCAGACAAGCAGCTGCAGTCT
Flanking genome sequence (113571 - 113620)	----+--------+--------+--------+--------+----* AAGAAAAACAAATTAGGGCAGGCCTCAGCATCTCTTTCCTATTACATAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	12914144	12928045	2	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 421 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH16633	1.5e-175	100.0	C8orf79 protein...	Homo sapiens
NP_065895	7.2e-174	99.0	hypothetical pr...	Homo sapiens
BAG10072	1e-158	100.0	C8orf79 protein...	synthetic construct
XP_540002	6.2e-141	80.2	similar to CG17...	Canis lupus fam...
XP_001487893	7.2e-141	82.7	similar to CG17...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013216	16	106	PF08241	Methyltransferase type 11

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGACCTAGCTGGAGTAATCTG
Primer_r	TAAGACTCCTCCAATAAACCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 8

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGACCTAGCTGGAGTAATCTG
Primer_r	TAAGACTCCTCCAATAAACCC
PCR product length	155 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp