KIAA1458

Product ID	ORK00843
Accession No	AB040891
Description	SLAIN motif family, member 2
Clone name	fh16694
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5843 bp) Predicted protein sequence (612 aa)
HaloTag ORF Clone	FHC00843
Flexi ORF Clone	FXC00843
Source	Human fetal brain
Rouge ID	mKIAA1458 by Kazusa Mouse cDNA Project

Length: 5843 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3983 bp
Genome contig ID	gi89161207f_47938400
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ACTAAAAATATTAAAAAGTATAAAGGTAAAAAATG
Flanking genome sequence (184435 - 184484)	----+--------+--------+--------+--------+----* ATAGTTGTCTGCAATCCCATAATCCGGAAATATTGAAGTACTGTCCGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	48038400	48122833	8	99.3	Perfect prediction

Length: 612 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100721	3.6e-181	98.4	hypothetical pr...	Macaca mulatta
Q9P270	2.2e-175	100.0	SLAIN motif-con...	Homo sapiens
BAF83695	6.5e-175	99.7	unnamed protein...	Homo sapiens
Q3MHV6	4.1e-170	96.9	SLAIN motif-con...	Bos taurus
BAE27166	4.4e-167	92.4	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCAGGCTATCCAAAACTTCAC
Primer_r	TCAATCTGTAGTTTCCTGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TCAGGCTATCCAAAACTTCAC
Primer_r	TCAATCTGTAGTTTCCTGGTG
PCR product length	136 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles