Order Kazusa clone(s) from : ![]() |
Product ID | ORK04776 |
---|---|
Accession No | AB040896 |
Description | DIP2 disco-interacting protein 2 homolog B (Drosophila) |
Clone name | fh18591s1 |
Vector information | |
cDNA sequence | DNA sequence (7334 bp) Predicted protein sequence (1166 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1463
by Kazusa Mouse cDNA Project
|
Note | We replaced fh18591, former representative clones for KIAA1463 with fh18591s1. (2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3833 bp |
---|---|
Genome contig ID | gi89161190f_49263212 |
PolyA signal sequence (AATAAA,-34) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (165509 - 165558) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 49363212 | 49428719 | 29 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000873 | 612 | 1085 | PF00501 | AMP-dependent synthetase and ligase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 4 | MFMVAFYGCLLAEVIPVPIEVPL | 26 | PRIMARY | 23 | 2 | 35 | QIGFLLGSCGIALALTSEVCLKG | 57 | SECONDARY | 23 | 3 | 643 | YPPGIELIAAFYGCLYAGCIPVT | 665 | PRIMARY | 23 | 4 | 781 | SSRQIAICLDPYCGLGFALWCLC | 803 | SECONDARY | 23 | 5 | 1079 | SIAECAVFTWTNLLVVVVELCGS | 1101 | PRIMARY | 23 | 6 | 1111 | LVTNVVLEEHYLIVGVVVVVDPG | 1133 | SECONDARY | 23 |
---|
![]() |
Primer_f | AGTAACTCTGGTAAAGCATCC |
---|---|
Primer_r | TAATGTGGATAGAGTAGGAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |