Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04776 |
---|---|
Accession No | AB040896 |
Description | DIP2 disco-interacting protein 2 homolog B (Drosophila) |
Clone name | fh18591s1 |
Vector information | |
cDNA sequence | DNA sequence (7334 bp) Predicted protein sequence (1166 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1463
by Kazusa Mouse cDNA Project
|
Note | We replaced fh18591, former representative clones for KIAA1463 with fh18591s1. (2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3833 bp |
---|---|
Genome contig ID | gi89161190f_49263212 |
PolyA signal sequence (AATAAA,-34) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (165509 - 165558) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 49363212 | 49428719 | 29 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000873 | 612 | 1085 | PF00501 | AMP-dependent synthetase and ligase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 4 | MFMVAFYGCLLAEVIPVPIEVPL | 26 | PRIMARY | 23 | 2 | 35 | QIGFLLGSCGIALALTSEVCLKG | 57 | SECONDARY | 23 | 3 | 643 | YPPGIELIAAFYGCLYAGCIPVT | 665 | PRIMARY | 23 | 4 | 781 | SSRQIAICLDPYCGLGFALWCLC | 803 | SECONDARY | 23 | 5 | 1079 | SIAECAVFTWTNLLVVVVELCGS | 1101 | PRIMARY | 23 | 6 | 1111 | LVTNVVLEEHYLIVGVVVVVDPG | 1133 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | AGTAACTCTGGTAAAGCATCC |
---|---|
Primer_r | TAATGTGGATAGAGTAGGAGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |