KIAA1464

Product ID	ORK00232
Accession No	AB040897
Description	RAN binding protein 10
Clone name	fh18679
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5224 bp) Predicted protein sequence (621 aa)
HaloTag ORF Clone	FHC00232
Flexi ORF Clone	FXC00232
Source	Human fetal brain
Rouge ID	mKIAA1464 by Kazusa Mouse cDNA Project

Length: 5224 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3356 bp
Genome contig ID	gi51511732r_66214475
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- CAGAATTATTTTTATTAAAATACACATCCATGAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCATGTGTGTCTGGTCTCTGTTTTGAGTCTTACTGAGGTTGGCACCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	66314475	66397945	14	99.3	Perfect prediction

Length: 621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6VN20	2.1e-212	100.0	Ran-binding pro...	Homo sapiens
XP_523396	7e-212	99.8	RAN binding pro...	Pan troglodytes
AAH99917	1.3e-211	99.7	RAN binding pro...	Homo sapiens
XP_001089228	2.6e-210	99.0	similar to Ran-...	Macaca mulatta
XP_001496629	5.2e-209	98.5	RAN binding pro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003877	101	222	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR003877	101	222	SM00449	SPla/RYanodine receptor SPRY
	IPR006595	292	349	SM00668	CTLH
	IPR013144	507	609	SM00757	CT11-RanBPM
ProfileScan	IPR001870	36	223	PS50188	B302
	IPR006594	254	286	PS50896	LisH dimerisation motif
	IPR006595	292	349	PS50897	CTLH

Primer_f	GCTCACAACTCAGGTATGCAC
Primer_r	AATGTGGAGGATGTCTGTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-