Order Kazusa clone(s) from : ![]() |
Product ID | ORK00240 |
---|---|
Accession No | AB040925 |
Description | dipeptidyl-peptidase 10 (non-functional), transcript variant 2 |
Clone name | bj00389 |
Vector information | |
cDNA sequence | DNA sequence (4394 bp) Predicted protein sequence (792 aa) |
HaloTag ORF Clone |
FHC00240
![]() |
Flexi ORF Clone | FXC00240 |
Source | Human adult brain |
Rouge ID |
mKIAA1492
by Kazusa Mouse cDNA Project
|
Note | We replaced fj08453, former representative clones for KIAA1492 with bj00389. (2001/2/22) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2015 bp |
---|---|
Genome contig ID | gi89161199f_115536272 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (782136 - 782185) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 115783283 | 116318406 | 23 | 99.4 | Both No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002469 | 129 | 496 | PF00930 | Peptidase S9B |
IPR001375 | 576 | 780 | PF00326 | Peptidase S9 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 32 | AIALLVILVVCSLITMSVILLTP | 54 | PRIMARY | 23 |
---|
Primer_f | GGCTGAGCTGCAATCTAACAC |
---|---|
Primer_r | TCTACTGATAACTGGCTGAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |