|
Order Kazusa clone(s) from : |
| Product ID | ORK06819 |
|---|---|
| Accession No | AB040927 |
| Description | SH3 domain containing ring finger 1 |
| Clone name | fj08673 |
| Vector information | |
| cDNA sequence | DNA sequence (4182 bp) Predicted protein sequence (638 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1494
by Kazusa Mouse cDNA Project
|
Length: 4182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2265 bp |
|---|---|
| Genome contig ID | gi89161207r_170151982 |
| PolyA signal sequence (ATTAAA,-27) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 4 | r | 170251982 | 170294358 | 8 | 99.3 | Terminal No-hit |
Length: 638 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001452 | 199 | 252 | PD000066 | Src homology-3 |
| IPR001452 | 590 | 636 | PD000066 | Src homology-3 | |
| FPrintScan | IPR001452 | 198 | 208 | PR00452 | Src homology-3 |
| IPR001452 | 596 | 611 | PR00452 | Src homology-3 | |
| IPR001452 | 613 | 622 | PR00452 | Src homology-3 | |
| IPR001452 | 626 | 638 | PR00452 | Src homology-3 | |
| HMMPfam | IPR001452 | 198 | 254 | PF00018 | Src homology-3 |
| IPR001452 | 590 | 638 | PF00018 | Src homology-3 | |
| HMMSmart | IPR001452 | 198 | 255 | SM00326 | Src homology-3 |
| IPR001452 | 582 | 638 | SM00326 | Src homology-3 | |
| ProfileScan | IPR001452 | 195 | 256 | PS50002 | Src homology-3 |
| IPR001452 | 585 | 638 | PS50002 | Src homology-3 |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | GCTTGGTGGGAGTGAATTTGC |
|---|---|
| Primer_r | CTTATTCATTACCAGGCTGTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 4
Experimental conditions| Panel name | unigene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |