Order Kazusa clone(s) from : ![]() |
Product ID | ORK06819 |
---|---|
Accession No | AB040927 |
Description | SH3 domain containing ring finger 1 |
Clone name | fj08673 |
Vector information | |
cDNA sequence | DNA sequence (4182 bp) Predicted protein sequence (638 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1494
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2265 bp |
---|---|
Genome contig ID | gi89161207r_170151982 |
PolyA signal sequence (ATTAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 170251982 | 170294358 | 8 | 99.3 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 199 | 252 | PD000066 | Src homology-3 |
IPR001452 | 590 | 636 | PD000066 | Src homology-3 | |
FPrintScan | IPR001452 | 198 | 208 | PR00452 | Src homology-3 |
IPR001452 | 596 | 611 | PR00452 | Src homology-3 | |
IPR001452 | 613 | 622 | PR00452 | Src homology-3 | |
IPR001452 | 626 | 638 | PR00452 | Src homology-3 | |
HMMPfam | IPR001452 | 198 | 254 | PF00018 | Src homology-3 |
IPR001452 | 590 | 638 | PF00018 | Src homology-3 | |
HMMSmart | IPR001452 | 198 | 255 | SM00326 | Src homology-3 |
IPR001452 | 582 | 638 | SM00326 | Src homology-3 | |
ProfileScan | IPR001452 | 195 | 256 | PS50002 | Src homology-3 |
IPR001452 | 585 | 638 | PS50002 | Src homology-3 |
![]() |
Primer_f | GCTTGGTGGGAGTGAATTTGC |
---|---|
Primer_r | CTTATTCATTACCAGGCTGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |