Gene/Protein Characteristic Table for KIAA1495
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00851
Accession No AB040928
Description leucine-rich repeats and calponin homology (CH) domain containing 2
Clone name fj08986
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4105 bp)
Predicted protein sequence (502 aa)
Source Human fetal brain
Rouge ID mKIAA1495 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4105 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2595 bp
Genome contig ID gi89161218r_114151441
PolyA signal sequence
(GATAAA,-14)
+----*----+----*----+----*----+----
ATATTACCGATGCAAACTGTGGATAAAGTTGAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAATTTAAGTCTGGTATTTCTTTTCTCCCTCTCTACCTCCTTTCTTA
Features of the protein sequence
Description

Length: 502 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX02618 2.4e-187 100.0 leucine-rich re...
Homo sapiens
Q5VUJ6 2.9e-187 100.0 Leucine-rich re...
Homo sapiens
CAH70721 2.7e-186 99.2 leucine-rich re...
Homo sapiens
XP_001102903 2.1e-185 99.0 similar to leuc...
Macaca mulatta
XP_549199 1.9e-178 95.6 similar to leuc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023233 1.3e-20 41.0 KIAA1016
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001715 380 493 PF00307 Calponin-like actin-binding
HMMSmart IPR001715 385 488 SM00033 Calponin-like actin-binding
ProfileScan IPR001715 379 492 PS50021 Calponin-like actin-binding
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GAAAATACAGCAGAACCTCAC
Primer_r ACATCAGAGCCTTGGTATAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp