Order Kazusa clone(s) from : ![]() |
Product ID | ORK00851 |
---|---|
Accession No | AB040928 |
Description | leucine-rich repeats and calponin homology (CH) domain containing 2 |
Clone name | fj08986 |
Vector information | |
cDNA sequence | DNA sequence (4105 bp) Predicted protein sequence (502 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1495
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2595 bp |
---|---|
Genome contig ID | gi89161218r_114151441 |
PolyA signal sequence (GATAAA,-14) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GAAAATACAGCAGAACCTCAC |
---|---|
Primer_r | ACATCAGAGCCTTGGTATAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |