KIAA1504

Gene/Protein Characteristic Table for KIAA1504

Order Kazusa clone(s) from :

Product ID	ORK00854
Accession No	AB040937
Description	ERI1 exoribonuclease family member 2
Clone name	hk04058
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3846 bp) Predicted protein sequence (447 aa)
HaloTag ORF Clone	FHC00854
Flexi ORF Clone	FXC00854
Source	Human adult brain
Rouge ID	mKIAA1504 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3846 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1380 bp
Genome contig ID	gi51511732r_20615167
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTTACTACCTAAAATAAATATTTGAAACACCAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGAGTTATGCATTTGTATGTTTTAGTATGTCTTGTTTGCTTGCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	20715167	20719012	1	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 447 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF85283	1.7e-177	99.8	unnamed protein...	Homo sapiens
A8K979	1.9e-177	99.8	Exonuclease dom...	Homo sapiens
BAG10082	1.1e-170	100.0	exonuclease dom...	synthetic construct
AAC31669	1.1e-169	99.8	Unknown gene pr...	Homo sapiens
XP_001149333	2e-134	99.1	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010666	351	399	PF06839	Zinc finger

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ATGTCATCAGTTCAGTTTGGG
Primer_r	ACAGCACCTTACAAATATCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ATGTCATCAGTTCAGTTTGGG
Primer_r	ACAGCACCTTACAAATATCCC
PCR product length	155 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp