Order Kazusa clone(s) from : ![]() |
Product ID | ORK04464 |
---|---|
Accession No | AB040942 |
Description | coiled-coil domain containing 88C |
Clone name | fh14721 |
Vector information | |
cDNA sequence | DNA sequence (5400 bp) Predicted protein sequence (1365 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1509
by Kazusa Mouse cDNA Project
|
Note | We replaced fg00804, former representative clones for KIAA1509 with fh14721. (2008/5/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1300 bp |
---|---|
Genome contig ID | gi51511730r_90707422 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 90807422 | 90849795 | 16 | 99.4 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | ACCTGCCTTCCTAGATTTCCC |
---|---|
Primer_r | CAGGTTACACATCGAGCTTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCTGCCTTCCTAGATTTCCC |
Primer_r | CAGGTTACACATCGAGCTTGC |
PCR product length | 171 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |