KIAA1509

Product ID	ORK04464
Accession No	AB040942
Description	coiled-coil domain containing 88C
Clone name	fh14721
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh14721 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGC GGACGCGTGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5400 bp) Predicted protein sequence (1365 aa)
Source	Human fetal brain
Rouge ID	mKIAA1509 by Kazusa Mouse cDNA Project
Note	We replaced fg00804, former representative clones for KIAA1509 with fh14721. (2008/5/2)

Length: 5400 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1300 bp
Genome contig ID	gi51511730r_90707422
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAAGGACAGGACTGTAATAAAATGGAATGGAACCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGCGTTCTGGCTTTCCTCACTGCACATTGTTAGCATCGGGTGGGCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	90807422	90849795	16	99.4	Terminal No-hit

Length: 1365 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P219	100.0	Protein Daple; ...	Homo sapiens
NP_001073883	99.9	DVL-binding pro...	Homo sapiens
XP_510123	99.5	similar to DVL-...	Pan troglodytes
XP_001144232	99.5	similar to DVL-...	Pan troglodytes
XP_001916920	85.0	similar to Prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033038	5.1e-28	37.6	KIAA1212

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ACCTGCCTTCCTAGATTTCCC
Primer_r	CAGGTTACACATCGAGCTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACCTGCCTTCCTAGATTTCCC
Primer_r	CAGGTTACACATCGAGCTTGC
PCR product length	171 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles