KIAA1527

Product ID	ORK04087
Accession No	AB040960
Description	alpha-kinase 1
Clone name	fj06850s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2794 bp) Predicted protein sequence (801 aa)
Source	Human fetal brain
Rouge ID	mKIAA1527 by Kazusa Mouse cDNA Project
Note	We replaced fj06850, former representative clones for KIAA1527 with fj06850s1. (2002/5/10)

Length: 2794 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	387 bp
Genome contig ID	gi89161207f_113471481
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GGGAGTTCTTTACATATTAAAAAAATGTGAGCCTT
Flanking genome sequence (110723 - 110772)	----+--------+--------+--------+--------+----* TGTGATACGAATTCAATTTGTTTTCCTGTCTTTTGACATTTGACTTTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	113571481	113582202	6	99.2	Perfect prediction

Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK94675	100.0	lymphocyte alph...	Homo sapiens
EAX06275	100.0	alpha-kinase 1,...	Homo sapiens
Q96QP1	99.9	Alpha-protein k...	Homo sapiens
BAG65473	99.8	unnamed protein...	Homo sapiens
NP_079420	99.5	alpha-kinase 1 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004166	578	786	PF02816	MHCK/EF2 kinase
HMMSmart	IPR004166	579	786	SM00811	MHCK/EF2 kinase
ProfileScan	IPR004166	574	794	PS51158	MHCK/EF2 kinase

Primer_f	ATGTGGAGACTGAGACTGAGC
Primer_r	TCTTTTCTGGCTGACCTGTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-