KIAA1539

Product ID	ORK02039
Accession No	AB040972
Description	family with sequence similarity 214, member B
Clone name	fg02356
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5771 bp) Predicted protein sequence (543 aa)
HaloTag ORF Clone	FHC02039
Flexi ORF Clone	FXC02039
Source	Human fetal brain
Rouge ID	mKIAA1539 by Kazusa Mouse cDNA Project

Length: 5771 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1098 bp
Genome contig ID	gi89161216r_34994222
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAAAAAGAAAGAATAAATTCTTGTTTGGAAACTTG
Flanking genome sequence (99898 - 99849)	----+--------+--------+--------+--------+----* AACTAAGCTCTACTTTTGTTGTTGTTGTTGTTGTTGGGGAGAGGGTGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	35094120	35101571	8	99.3	Perfect prediction

Length: 543 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001165916	1.3e-179	99.1	hypothetical pr...	Pan troglodytes
XP_001090314	4.7e-178	98.7	similar to CG90...	Macaca mulatta
XP_852785	5.4e-168	93.7	similar to CG90...	Canis lupus fam...
BAE36360	2e-161	90.9	unnamed protein...	Mus musculus
AAH71191	2.2e-161	90.9	RIKEN cDNA B230...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037791	1.3e-17	54.2	KIAA1370

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TCCCACTCTCAGATATTGCTC
Primer_r	TGGCTTTCAGAGATAGGTCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-