KIAA1370

Product ID	ORK05656
Accession No	AB037791
Description	family with sequence similarity 214, member A
Clone name	fj03240
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3863 bp) Predicted protein sequence (1107 aa)
Source	Human fetal brain
Rouge ID	mKIAA1370 by Kazusa Mouse cDNA Project

Length: 3863 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	490 bp
Genome contig ID	gi51511731r_50561153
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AAAATGAGAATAAAATGTTGAGCTTCTTTAAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACACACTATGCAAGCATGTGTACTTTTTATATCTCTCATGTTTAGTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	50661153	50758101	13	99.5	Perfect prediction

Length: 1107 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF85606	99.6	unnamed protein...	Homo sapiens
BAG57301	99.7	unnamed protein...	Homo sapiens
XP_001087128	96.9	similar to CG90...	Macaca mulatta
XP_001087724	96.9	similar to CG90...	Macaca mulatta
XP_851212	84.5	similar to CG90...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040972	1.8e-35	54.2	KIAA1539

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TCCTTATATGGGTGTGATTAC
Primer_r	TTGTCGTAGGAATGTCTGATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-