KIAA1549

Product ID	ORK00246
Accession No	AB046769
Description	KIAA1549
Clone name	fh16155s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6395 bp) Predicted protein sequence (1865 aa)
Flexi ORF Clone	FXC00246
Source	Human fetal brain
Rouge ID	mKIAA1549 by Kazusa Mouse cDNA Project
Note	We replaced fh16155, former representative clones for KIAA1549 with fh16155s1. (2003/8/28)

Length: 6395 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	797 bp
Genome contig ID	gi89161213r_138072394
PolyA signal sequence (AATACA,-25)	+--------+--------+----*----+---- GATTATCCAAAATACAGATCAAAGTTTAGATCTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTTCATTGTATTTGCTGTTTCTTAATTGGGCACACACAACTCCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	138172394	138254704	19	99.6	Perfect prediction

Length: 1865 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_065961	99.8	hypothetical pr...	Homo sapiens
XP_001107649	95.2	similar to K06A...	Macaca mulatta
EAW83899	99.9	hCG1811076 [Hom...	Homo sapiens
XP_991947	71.9	similar to D630...	Mus musculus
XP_979772	71.9	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000792	1076	1103	PS00622	Bacterial regulatory protein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1231	WVIVGVVIPVLVVMVIVVILYWK	1253	PRIMARY	23

Primer_f	GAAGAGCTCACGGATAAAACG
Primer_r	ATGTAGGCTGAGTTGTGGACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GAAGAGCTCACGGATAAAACG
Primer_r	ATGTAGGCTGAGTTGTGGACG
PCR product length	150 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles