KIAA1554

Product ID	ORK06668
Accession No	AB046774
Description	ring finger protein 213
Clone name	fh17222
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5705 bp) Predicted protein sequence (1320 aa)
Source	Human fetal brain
Rouge ID	mKIAA1554 by Kazusa Mouse cDNA Project

Length: 5705 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1741 bp
Genome contig ID	gi51511734f_75852096
PolyA signal sequence (AATATA,-22)	+--------+--------+----*----+---- TTGTTTGTACAGAAATATACTGGCCTAGCAGAGGC
Flanking genome sequence (131540 - 131589)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATGAATTTTATTTTACTTGTCACACCTGTCTTAATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	75952096	75983634	28	99.9	Perfect prediction

Length: 1320 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH56308	100.0	hypothetical pr...	Homo sapiens
BAB84856	100.0	FLJ00039 protei...	Homo sapiens
CAE45967	100.0	hypothetical pr...	Homo sapiens
CAH56189	100.0	hypothetical pr...	Homo sapiens
Q63HN8	100.0	RING finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037825	0.00071	47.6	KIAA1404

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	110	148	PF00097	Zinc finger
HMMSmart	IPR001841	110	148	SM00184	Zinc finger
ProfileScan	IPR001841	110	148	PS50089	Zinc finger

Primer_f	GACTCAGCCATGCACACCTTG
Primer_r	CACAGATGACTAAATGCCAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-