KIAA1404

Product ID	ORK00228
Accession No	AB037825
Description	zinc finger, NFX1-type containing 1
Clone name	eg01672
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7184 bp) Predicted protein sequence (1925 aa)
HaloTag ORF Clone	FHC00228
Flexi ORF Clone	FXC00228
Source
Rouge ID	mKIAA1404 by Kazusa Mouse cDNA Project
Note	We replaced fg02672, former representative clones for KIAA1404 with eg01672. (2007/1/24)

Length: 7184 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1362 bp
Genome contig ID	gi51511747r_47195848
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTAGCTTATAAAGCCAATTAAAAACGATGATTGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCAGTGGTCCACGTGTATCCTCAATTTTCAGAAGCAACTCAGCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	47295848	47327981	14	99.2	Perfect prediction

Length: 1925 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW75662	100.0	zinc finger, NF...	Homo sapiens
Q9P2E3	99.9	NFX1-type zinc ...	Homo sapiens
XP_001098884	98.4	zinc finger, NF...	Macaca mulatta
XP_001503613	90.6	similar to NFX1...	Equus caballus
XP_589621	88.8	similar to NFX1...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	6.6e-07	31.9	KIAA0221
D63483	1.5e-06	27.2	KIAA0149
D42046	2.6e-05	27.2	KIAA0083
AB011132	4.5e-05	32.7	KIAA0560
AB058677	0.0003	27.3	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000967	1305	1327	PF01422	Zinc finger
	IPR000967	1337	1353	PF01422	Zinc finger
	IPR000967	1389	1407	PF01422	Zinc finger
	IPR000967	1448	1470	PF01422	Zinc finger
	IPR000967	1478	1495	PF01422	Zinc finger
	IPR000967	1553	1571	PF01422	Zinc finger
HMMSmart	IPR000967	1305	1331	SM00438	Zinc finger
	IPR000967	1334	1353	SM00438	Zinc finger
	IPR000967	1389	1407	SM00438	Zinc finger
	IPR000967	1478	1495	SM00438	Zinc finger
	IPR000967	1553	1571	SM00438	Zinc finger

Primer_f	AGACTGCACCAACTCACCCTG
Primer_r	AGGTTACAGGAAAGGGGTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-