KIAA0083

Product ID	ORK00400
Accession No	D42046
Description	DNA replication helicase/nuclease 2, transcript variant 1
Clone name	ha03631
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4207 bp) Predicted protein sequence (1077 aa)
HaloTag ORF Clone	FHC00400
Flexi ORF Clone	FXC00400
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0083 by Kazusa Mouse cDNA Project

Length: 4207 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	973 bp
Genome contig ID	gi89161187r_69743883
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAGTTTTTTATTTAATAAATTTTTTCTACTAATGG
Flanking genome sequence (99945 - 99896)	----+--------+--------+--------+--------+----* ATCTTAACTGTGTCAATTATTATTAATACTGAATAATAATTAAACTCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	69843828	69901678	21	99.8	Perfect prediction

Length: 1077 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073918	100.0	DNA replication...	Homo sapiens
XP_001163213	99.4	DNA2 DNA replic...	Pan troglodytes
P51530	100.0	DNA2-like helic...	Homo sapiens
EAW54296	98.8	hCG32858 [Homo ...	Homo sapiens
CAI17238	100.0	DNA2 DNA replic...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	4.5e-12	29.9	KIAA0221
AB037825	6.1e-09	27.9	KIAA1404
AB014525	1.8e-07	30.4	KIAA0625
D29677	1.3e-06	24.0	KIAA0054
AB051556	4.4e-06	27.2	KIAA1769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014808	78	300	PF08696	DNA replication factor Dna2

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTATGTTTGGGGGTATCACTC
Primer_r	AACCCTCAAGAGAAATGGAAG
PCR product length	180 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles