KIAA0625

Product ID	ORK06791
Accession No	AB014525
Description	senataxin
Clone name	hg04796s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10737 bp) Predicted protein sequence (2663 aa)
Source	Human adult brain
Rouge ID	mKIAA0625 by Kazusa Mouse cDNA Project
Note	We replaced hg04796, former representative clones for KIAA0625 with hg04796s1. (2003/8/28)

Length: 10737 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2743 bp
Genome contig ID	gi89161216r_134026704
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GAGGAAATGGCAGAATTAAAAGCAGAAACAAGAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGACATGGATTAGAGGTTATGTATTATGAAGTAAACTACAAGGTACTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	134126704	134214596	24	99.6	Perfect prediction

Length: 2663 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10365	100.0	senataxin [synt...	synthetic construct
CAI40854	99.9	senataxin [Homo...	Homo sapiens
AAR13367	99.8	ataxia/oculomot...	Homo sapiens
Q7Z333	99.8	Probable helica...	Homo sapiens
CAD98045	99.7	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	1.9e-13	29.8	KIAA0221
AB011132	1.3e-06	21.7	KIAA0560
D42046	0.00029	30.4	KIAA0083

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TTTGTCCCCAGAGTCAGCCAC
Primer_r	GATAGAGCCCTTGACCCAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTTGTCCCCAGAGTCAGCCAC
Primer_r	GATAGAGCCCTTGACCCAGAC
PCR product length	125 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles