KIAA0221

Product ID	ORK00466
Accession No	D86988
Description	UPF1 regulator of nonsense transcripts homolog (yeast), transcript variant 1
Clone name	ha02799
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5311 bp) Predicted protein sequence (1151 aa)
HaloTag ORF Clone	FHC00466
Flexi ORF Clone	FXC00466
Source	Myeloblast cell line (KG-1)

Length: 5311 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1712 bp
Genome contig ID	gi42406306f_18703810
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGTCACCAAATATTAATAAACAGTTTTGACTTC
Flanking genome sequence (136230 - 136279)	----+--------+--------+--------+--------+----* ACACCAAGGTTGGATAAACTGCAGGGGGTGGAGGGTGCTGGGGTTTTGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	18803810	18840038	24	99.6	Perfect prediction

Length: 1151 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09664	100.0	regulator of no...	synthetic construct
Q92900	99.9	Regulator of no...	Homo sapiens
EDL28813	98.2	UPF1 regulator ...	Mus musculus
Q9EPU0	98.5	Regulator of no...	Mus musculus
BAE28409	98.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014525	5.2e-12	29.5	KIAA0625
AB011132	1.9e-07	24.2	KIAA0560
D42046	1.3e-06	29.9	KIAA0083
AB037825	5e-06	32.0	KIAA1404

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006935	501	567	PF04851	Restriction endonuclease

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTTTCGGTTTCCCCTTCTTCC
Primer_r	ACATTGCCTTGGTACAGTGCG
PCR product length	208 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles