Order Kazusa clone(s) from : ![]() |
Product ID | ORK00466 |
---|---|
Accession No | D86988 |
Description | UPF1 regulator of nonsense transcripts homolog (yeast), transcript variant 1 |
Clone name | ha02799 |
Vector information | |
cDNA sequence | DNA sequence (5311 bp) Predicted protein sequence (1151 aa) |
HaloTag ORF Clone |
FHC00466
![]() |
Flexi ORF Clone | FXC00466 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1712 bp |
---|---|
Genome contig ID | gi42406306f_18703810 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (136230 - 136279) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 18803810 | 18840038 | 24 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CTTTCGGTTTCCCCTTCTTCC |
Primer_r | ACATTGCCTTGGTACAGTGCG |
PCR product length | 208 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |