KIAA1561

Product ID	ORK01631
Accession No	AB046781
Description	uveal autoantigen with coiled-coil domains and ankyrin repeats, transcript variant 1
Clone name	fh20178s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1251) was subcloned upstream of the cDNA (1252-4373). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA GGGAATTCGA TT-5' end of cDNA.
cDNA sequence	DNA sequence (4373 bp) Predicted protein sequence (1416 aa)
HaloTag ORF Clone	FHC01631
Flexi ORF Clone	FXC01631
Source	Human fetal brain
Rouge ID	mKIAA1561 by Kazusa Mouse cDNA Project
Note	We replaced fh20178, former representative clones for KIAA1561 with fh20178s1. (2002/5/10)

Length: 4373 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	122 bp
Genome contig ID	gi51511731r_68636327
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGCTGGTATAATTAAAATAAAATATATTTTGTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGGTAGGTTTTTTTTTAAAATTAGATGAATATGTTAGTCTTTTTCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	68736327	68842800	19	99.3	Perfect prediction

Length: 1416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI43267	99.9	Uveal autoantig...	Homo sapiens
AAG49577	99.7	uveal autoantig...	Homo sapiens
XP_001174957	99.3	uveal autoantig...	Pan troglodytes
AAG49576	99.7	uveal autoantig...	Bos taurus
XP_001088091	98.2	similar to uvea...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037755	9.6e-22	27.2	KIAA1334
AB075861	2.7e-15	30.1	KIAA1981
AB028997	5.2e-07	22.0	KIAA1074
D13629	4.3e-06	22.5	KIAA0004
AB002371	5e-06	21.9	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	101	113	PR01415	Ankyrin
FPrintScan	IPR002110	179	191	PR01415	Ankyrin
HMMPfam	IPR002110	38	66	PF00023	Ankyrin
	IPR002110	67	99	PF00023	Ankyrin
	IPR002110	100	132	PF00023	Ankyrin
	IPR002110	133	165	PF00023	Ankyrin
	IPR002110	166	198	PF00023	Ankyrin
	IPR002110	199	231	PF00023	Ankyrin
	IPR007596	811	833	PF04508	Viral A-type inclusion protein repeat
HMMSmart	IPR002110	33	63	SM00248	Ankyrin
	IPR002110	67	96	SM00248	Ankyrin
	IPR002110	100	129	SM00248	Ankyrin
	IPR002110	133	162	SM00248	Ankyrin
	IPR002110	166	195	SM00248	Ankyrin
	IPR002110	199	228	SM00248	Ankyrin
ProfileScan	IPR002110	38	264	PS50297	Ankyrin
	IPR002110	67	99	PS50088	Ankyrin
	IPR002110	100	132	PS50088	Ankyrin
	IPR002110	133	165	PS50088	Ankyrin
	IPR002110	166	198	PS50088	Ankyrin
	IPR002110	199	231	PS50088	Ankyrin
	IPR000727	1318	1380	PS50192	Target SNARE coiled-coil region

Primer_f	CATGCCGAAATTAAAGCCCAG
Primer_r	TGTCTGCTCTGATAACTGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-