|
Order Kazusa clone(s) from : |
| Product ID | ORK04536 |
|---|---|
| Accession No | AB002371 |
| Description | centrosomal protein 290kDa |
| Clone name | hh00281 |
| Vector information | |
| cDNA sequence | DNA sequence (5967 bp) Predicted protein sequence (1540 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0373
by Kazusa Mouse cDNA Project
|
Length: 5967 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 1540 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR
|
|---|
Experimental conditions| Primer_f | TTTTCTTCCTCTTCTACCTGC |
|---|---|
| Primer_r | AGGGAAACAGGGGTAGATGAG |
| PCR conditions | 95 °C 30 sec 61 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 12
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TTTTCTTCCTCTTCTACCTGC |
| Primer_r | AGGGAAACAGGGGTAGATGAG |
| PCR product length | 119 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |