Gene/Protein Characteristic Table for KIAA0373
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04536
Accession No AB002371
Description centrosomal protein 290kDa
Clone name hh00281
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5967 bp)
Predicted protein sequence (1540 aa)
Source Human adult brain
Rouge ID mKIAA0373 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5967 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1540 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15078 0 100.0 Centrosomal pro...
Homo sapiens
DAA05591 0 100.0 TPA_exp: centro...
Homo sapiens
EAW97414 0 100.0 centrosomal pro...
Homo sapiens
XP_001101114 0 97.8 centrosomal pro...
Macaca mulatta
XP_001100925 0 97.8 centrosomal pro...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020673 1.6e-08 22.9 KIAA0866
AB046781 4.5e-07 21.1 KIAA1561
AB002334 5.2e-06 22.1 KIAA0336
D13629 1e-05 21.3 KIAA0004
D86970 1.4e-05 23.4 KIAA0216
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TTTTCTTCCTCTTCTACCTGC
Primer_r AGGGAAACAGGGGTAGATGAG
PCR conditions 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 12
Experimental conditions
Panel name GeneBridge 4
Primer_f TTTTCTTCCTCTTCTACCTGC
Primer_r AGGGAAACAGGGGTAGATGAG
PCR product length 119 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp