KIAA0866

Product ID	ORK01129
Accession No	AB020673
Description	myosin, heavy chain 11, smooth muscle, transcript variant SM1A
Clone name	hk00546s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6846 bp) Predicted protein sequence (1984 aa)
HaloTag ORF Clone	FHC01129
Flexi ORF Clone	FXC01129
Source	Human adult brain
Rouge ID	mKIAA0866 by Kazusa Mouse cDNA Project
Note	We replaced hk06733, former representative clones for KIAA0866 with hk00546s1. (2002/12/27)

Length: 6846 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	852 bp
Genome contig ID	gi51511732r_15604497
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTAAAAACACTTTCACTAATAAATGGTTATAAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAATGTCGTTGGCTTTTCTGTTGAGCTGTTTTCTATAGAGGAAAAGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	15704497	15858356	41	100.0	Perfect prediction

Length: 1984 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P35749	100.0	Myosin-11; Myos...	Homo sapiens
AAS98910	99.6	smooth muscle m...	Homo sapiens
EAW53927	99.8	myosin, heavy p...	Homo sapiens
XP_850764	97.9	similar to smoo...	Canis lupus fam...
XP_862820	97.7	similar to smoo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111886	1.6e-108	59.8	KIAA2034
AB040945	3.3e-99	40.4	KIAA1512
AB023217	2.8e-74	37.1	KIAA1000
AB032945	2.4e-41	28.0	KIAA1119
AB018270	2.4e-25	35.8	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	227	262	PD000355	Myosin head
FPrintScan	IPR001609	127	146	PR00193	Myosin head
	IPR001609	183	208	PR00193	Myosin head
	IPR001609	235	262	PR00193	Myosin head
	IPR001609	466	494	PR00193	Myosin head
	IPR001609	520	548	PR00193	Myosin head
HMMPfam	IPR004009	45	87	PF02736	Myosin
	IPR001609	99	783	PF00063	Myosin head
	IPR000048	799	819	PF00612	IQ calmodulin-binding region
	IPR002928	1085	1942	PF01576	Myosin tail
HMMSmart	IPR001609	91	796	SM00242	Myosin head
HMMSmart	IPR000048	797	819	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	798	827	PS50096	IQ calmodulin-binding region

Primer_f	CACCTCAGACACGCACAGTTC
Primer_r	GTCAGGGTGTAAACAGTGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CACCTCAGACACGCACAGTTC
Primer_r	GTCAGGGTGTAAACAGTGCAG
PCR product length	110 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles