Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01115 |
---|---|
Accession No | AB018270 |
Description | myosin ID, transcript variant 1 |
Clone name | hk03490y1 |
Vector information | |
cDNA sequence | DNA sequence (5182 bp) Predicted protein sequence (1010 aa) |
HaloTag ORF Clone |
FHC01115
|
Flexi ORF Clone | FXC01115 |
Source | Human adult brain |
Note | We replaced hk03490, former representative clones for KIAA0727 with hk03490y1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2149 bp |
---|---|
Genome contig ID | gi51511734r_27743741 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 27843741 | 28228015 | 22 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001609 | 142 | 169 | PD000355 | Myosin head |
FPrintScan | IPR001609 | 43 | 62 | PR00193 | Myosin head |
IPR001609 | 99 | 124 | PR00193 | Myosin head | |
IPR001609 | 147 | 174 | PR00193 | Myosin head | |
IPR001609 | 382 | 410 | PR00193 | Myosin head | |
IPR001609 | 435 | 463 | PR00193 | Myosin head | |
HMMPfam | IPR001609 | 17 | 686 | PF00063 | Myosin head |
IPR000048 | 703 | 723 | PF00612 | IQ calmodulin-binding region | |
IPR000048 | 725 | 745 | PF00612 | IQ calmodulin-binding region | |
IPR010926 | 806 | 1009 | PF06017 | Myosin tail 2 | |
HMMSmart | IPR001609 | 7 | 700 | SM00242 | Myosin head |
IPR000048 | 701 | 723 | SM00015 | IQ calmodulin-binding region | |
ProfileScan | IPR000048 | 702 | 730 | PS50096 | IQ calmodulin-binding region |
RT-PCR-ELISA |
Primer_f | TGTGGCAACTGCAAAAGGATC |
---|---|
Primer_r | GTCTACAATCATGCCCGCTTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGTGGCAACTGCAAAAGGATC |
Primer_r | GTCTACAATCATGCCCGCTTC |
PCR product length | 93 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |