KIAA0799

Product ID	ORK01122
Accession No	AB018342
Description	myosin X
Clone name	fg01615y1
Vector information	The cDNA fragment was originally inserted at XhoI-NotI site ... The cDNA fragment was originally inserted at XhoI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC(=attB1)-5' end of cDNA.
cDNA sequence	DNA sequence (8020 bp) Predicted protein sequence (2111 aa)
HaloTag ORF Clone	FHC01122
Flexi ORF Clone	FXC01122
Source	Human fetal brain
Rouge ID	mKIAA0799 by Kazusa Mouse cDNA Project
Note	We replaced hg01449, former representative clones for KIAA0799 with fg01615y1. (2002/12/27)

Length: 8020 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1388 bp
Genome contig ID	gi51511721r_16618413
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCTCACAGAAGTTCTGACAATAAAAGATACTAGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACACGCTGTGTGTTTCCTTTATCAGAGGAGGCTCTAAAAACCATGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	16718413	16989372	40	99.7	Perfect prediction

Length: 2111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001175408	97.9	myosin X [Pan t...	Pan troglodytes
AAI50286	100.0	Myosin X [Homo ...	Homo sapiens
Q9HD67	100.0	Myosin-X; Uncon...	Homo sapiens
AAF37875	100.0	myosin X [Homo ...	Homo sapiens
AAF68025	99.9	myosin X [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032945	4.9e-30	34.2	KIAA1119
AB020673	1.4e-25	34.0	KIAA0866
AB040945	1.7e-24	33.4	KIAA1512
AB023217	1.2e-22	32.4	KIAA1000
AB018270	1.1e-20	35.1	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	247	281	PD000355	Myosin head
FPrintScan	IPR001609	146	165	PR00193	Myosin head
	IPR001609	203	228	PR00193	Myosin head
	IPR001609	255	282	PR00193	Myosin head
	IPR001609	482	510	PR00193	Myosin head
	IPR001609	535	563	PR00193	Myosin head
HMMPfam	IPR001609	118	780	PF00063	Myosin head
	IPR000048	796	816	PF00612	IQ calmodulin-binding region
	IPR000048	819	839	PF00612	IQ calmodulin-binding region
	IPR000048	842	862	PF00612	IQ calmodulin-binding region
	IPR001849	1266	1363	PF00169	Pleckstrin-like
	IPR001849	1446	1550	PF00169	Pleckstrin-like
	IPR000857	1636	1748	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000159	1751	1806	PF00788	Ras-association
HMMSmart	IPR001609	110	793	SM00242	Myosin head
	IPR000048	794	816	SM00015	IQ calmodulin-binding region
	IPR000048	817	839	SM00015	IQ calmodulin-binding region
	IPR000048	840	862	SM00015	IQ calmodulin-binding region
	IPR001849	1266	1365	SM00233	Pleckstrin-like
	IPR001849	1446	1552	SM00233	Pleckstrin-like
	IPR000857	1600	1748	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	1749	2011	SM00295	Band 4.1
ProfileScan	IPR000048	796	819	PS50096	IQ calmodulin-binding region
	IPR000048	841	870	PS50096	IQ calmodulin-binding region
	IPR001849	1265	1363	PS50003	Pleckstrin-like
	IPR001849	1445	1550	PS50003	Pleckstrin-like
	IPR000857	1600	1748	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000299	1753	2097	PS50057	Band 4.1

Primer_f	CGTGTGGGTAGACTTAGTTGG
Primer_r	ATAATGGTGGTCTGAACAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	CGTGTGGGTAGACTTAGTTGG
Primer_r	ATAATGGTGGTCTGAACAAGG
PCR product length	134 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles