KIAA1000

Product ID	ORK02010
Accession No	AB023217
Description	myosin, heavy chain 15
Clone name	hk09604y2
Vector information	The cDNA fragment was originally inserted at EcoRI-NotI site ... The cDNA fragment was originally inserted at EcoRI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GAATTCCCGG GTCGACTAGT AC-5' end of cDNA.
cDNA sequence	DNA sequence (7074 bp) Predicted protein sequence (1956 aa)
HaloTag ORF Clone	FHC02010
Flexi ORF Clone	FXC02010
Source	Human adult brain
Note	We replaced hk09604y1 and hk09604, former representative clones for KIAA1000 with hk09604y2. (2008/2/6,2002/12/27)

Length: 7074 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1176 bp
Genome contig ID	gi89161205r_109482235
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAGGCTGAAGCTCTATAATAAATCTTTATTCTGTC
Flanking genome sequence (99671 - 99622)	----+--------+--------+--------+--------+----* ATTCTCTGATTCTGCCTCCCTGATCCAACCCTGACTCATATGGGTAGCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	109581906	109730859	42	99.9	Perfect prediction

Length: 1956 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2K3	100.0	Myosin-15; Myos...	Homo sapiens
EAW79726	99.9	hCG1811516 [Hom...	Homo sapiens
XP_516637	99.0	myosin, heavy p...	Pan troglodytes
XP_001095819	96.4	similar to Myos...	Macaca mulatta
XP_848707	82.7	similar to myos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040945	7.7e-160	60.6	KIAA1512
AB020673	1.8e-80	37.1	KIAA0866
AB111886	3e-47	33.1	KIAA2034
AB032945	9.9e-40	30.6	KIAA1119
AB018270	4.4e-30	33.3	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	240	275	PD000355	Myosin head
FPrintScan	IPR001609	143	162	PR00193	Myosin head
	IPR001609	199	224	PR00193	Myosin head
	IPR001609	248	275	PR00193	Myosin head
	IPR001609	478	506	PR00193	Myosin head
	IPR001609	532	560	PR00193	Myosin head
HMMPfam	IPR004009	61	103	PF02736	Myosin
	IPR001609	115	788	PF00063	Myosin head
	IPR002928	1090	1948	PF01576	Myosin tail
HMMSmart	IPR001609	107	801	SM00242	Myosin head

Primer_f	GGGTTCTGTTTGTTCTTATGG
Primer_r	GTGCTGGTGGAGAAGTCTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGTTCTGTTTGTTCTTATGG
Primer_r	GTGCTGGTGGAGAAGTCTAGG
PCR product length	123 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles