KIAA2034

Product ID	ORK06071
Accession No	AB111886
Description	myosin, heavy chain 14, non-muscle
Clone name	ah04445
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5472 bp) Predicted protein sequence (1571 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA2034 by Kazusa Mouse cDNA Project

Length: 5472 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	755 bp
Genome contig ID	gi42406306f_55344121
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CTGGCAGAAATAAACTCCAACCCGACTGGACCATC
Flanking genome sequence (161495 - 161544)	----+--------+--------+--------+--------+----* TCTGTGGCTGTGTGTGTTCCTGCAGGGGGTCTCTGATGGGGCAGGATGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	55444121	55505614	31	99.8	Perfect prediction

Length: 1571 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06723	100.0	MYH14 variant p...	Homo sapiens
ABR10605	91.1	nonmuscle myosi...	Mus musculus
NP_079005	97.9	myosin, heavy c...	Homo sapiens
NP_001070654	97.9	myosin, heavy c...	Homo sapiens
XP_524343	97.9	myosin, heavy p...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	8.6e-124	59.8	KIAA0866
AB040945	1.6e-57	36.8	KIAA1512
AB023217	8.8e-50	33.1	KIAA1000
D86970	1.1e-19	26.8	KIAA0216
AB037740	5.6e-15	25.8	KIAA1319

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001609	16	44	PR00193	Myosin head
FPrintScan	IPR001609	70	98	PR00193	Myosin head
HMMPfam	IPR001609	3	364	PF00063	Myosin head
	IPR000048	380	400	PF00612	IQ calmodulin-binding region
	IPR002928	666	1523	PF01576	Myosin tail
HMMSmart	IPR001609	1	377	SM00242	Myosin head
HMMSmart	IPR000048	378	400	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	380	408	PS50096	IQ calmodulin-binding region

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-