KIAA0336

Product ID	ORK00054
Accession No	AB002334
Description	GRIP and coiled-coil domain containing 2
Clone name	hg01120
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6773 bp) Predicted protein sequence (1635 aa)
HaloTag ORF Clone	FHC00054
Flexi ORF Clone	FXC00054
Source	Human adult brain
Rouge ID	mKIAA0336 by Kazusa Mouse cDNA Project

Length: 6773 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1768 bp
Genome contig ID	gi89161199f_108332128
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTATTTTAATATTTCTATTAAATATGTTTAACTGT
Flanking genome sequence (160159 - 160208)	----+--------+--------+--------+--------+----* ATATTTTTATGGCTGCTCTTTTATGTTACACACTGTCTCTTTGGGGTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	108432128	108492285	22	99.7	Perfect prediction

Length: 1635 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_852118	100.0	GRIP and coiled...	Homo sapiens
EAW53882	100.0	GRIP and coiled...	Homo sapiens
Q8IWJ2	99.9	GRIP and coiled...	Homo sapiens
XP_001135112	98.4	GRIP and coiled...	Pan troglodytes
XP_001493196	86.1	GRIP and coiled...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	4.7e-09	23.6	KIAA0866
AB023217	2.5e-08	20.6	KIAA1000
AB029004	1.2e-05	22.1	KIAA1081
AB002371	1.5e-05	22.0	KIAA0373
AB007862	2.9e-05	21.7	KIAA0402

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000237	1563	1608	PF01465	GRIP
HMMSmart	IPR000237	1563	1610	SM00755	GRIP
ProfileScan	IPR000237	1560	1610	PS50913	GRIP

Primer_f	CATTACACTTCCTCTCATTGC
Primer_r	TAGTCTCTGCTTACGAATGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CATTACACTTCCTCTCATTGC
Primer_r	TAGTCTCTGCTTACGAATGTC
PCR product length	112 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles