KIAA0402

Product ID	ORK06295
Accession No	AB007862
Description	pericentrin
Clone name	hg01127s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10482 bp) Predicted protein sequence (3284 aa)
Source	Human adult brain
Rouge ID	mKIAA0402 by Kazusa Mouse cDNA Project
Note	We replaced hg01127 and hf00540, former representative clones for KIAA0402 with hg01127s1. (2002/5/10,2003/8/28)

Length: 10482 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	438 bp
Genome contig ID	gi51511750f_46469230
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- AAAAGGAATAAAATTTAATCACTGTTTTGTTTGTG
Flanking genome sequence (220878 - 220927)	----+--------+--------+--------+--------+----* AATAGCCCTTGTGTTGTTTTTTTTTTCCATTTTATCCATTTTATCAGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	f	46569230	46690106	47	99.8	Perfect prediction

Length: 3284 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX09279	100.0	pericentrin (ke...	Homo sapiens
O95613	97.2	Pericentrin; Pe...	Homo sapiens
AAP46636	97.2	pericentrin B [...	Homo sapiens
NP_006022	97.2	pericentrin [Ho...	Homo sapiens
EAX09277	99.2	pericentrin (ke...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018346	1.4e-10	25.2	KIAA0803
AB002334	1.6e-05	21.5	KIAA0336
D13629	0.00031	21.1	KIAA0004
AB002376	0.00046	22.3	KIAA0378
AB028975	0.00055	23.9	KIAA1052

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TGAAGTTTCCATCTGTACACG
Primer_r	TGTGCTGTTGTGTCCTATCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGAAGTTTCCATCTGTACACG
Primer_r	TGTGCTGTTGTGTCCTATCGG
PCR product length	114 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles