KIAA0378

Product ID	ORK00520
Accession No	AB002376
Description	ELKS/RAB6-interacting/CAST family member 2
Clone name	hh00502s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6137 bp) Predicted protein sequence (970 aa)
HaloTag ORF Clone	FHC00520
Flexi ORF Clone	FXC00520
Source	Human adult brain
Rouge ID	mKIAA0378 by Kazusa Mouse cDNA Project
Note	We replaced hh00502, former representative clones for KIAA0378 with hh00502s1. (2002/5/10)

Length: 6137 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3007 bp
Genome contig ID	gi89161205r_55417376
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TATTCATCAAATAAACCTTGTTTCTTTCTGAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTCATTCTATCTCTAATAAATGCTCCAATTGTGCAGTTTCTAACATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	55517376	56477431	17	99.4	Perfect prediction

Length: 970 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15083	100.0	ERC protein 2.	Homo sapiens
XP_516542	99.9	cytomatrix prot...	Pan troglodytes
XP_001101499	99.7	similar to cyto...	Macaca mulatta
XP_001490805	99.5	ELKS/RAB6-inter...	Equus caballus
XP_849232	99.5	similar to cyto...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029004	1.1e-90	69.1	KIAA1081
AB033101	7.9e-05	24.9	KIAA1275
AB014535	0.00016	20.9	KIAA0635
D13629	0.00017	21.5	KIAA0004
AB002371	0.00019	22.8	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AATAAGGCGATCAGCACAAAG
Primer_r	CATGTGGGTTGTGATATTGAC
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATAAGGCGATCAGCACAAAG
Primer_r	CATGTGGGTTGTGATATTGAC
PCR product length	206 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles