KIAA0635

Product ID	ORK04533
Accession No	AB014535
Description	centrosomal protein 135kDa
Clone name	hj03253
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5138 bp) Predicted protein sequence (864 aa)
Source	Human adult brain
Rouge ID	mKIAA0635 by Kazusa Mouse cDNA Project

Length: 5138 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1765 bp
Genome contig ID	gi89161207f_56425789
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- ATGGAAATCTTTTAATAAATATATGTAAATAAAAT
Flanking genome sequence (168240 - 168289)	----+--------+--------+--------+--------+----* AAAAAATATTTGTCTCCACCTTTTCCCCAAAAGCAACAGCAAGACATATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	56525789	56594027	19	99.5	Perfect prediction

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q66GS9	100.0	Centrosomal pro...	Homo sapiens
AAI36536	99.9	Centrosomal pro...	Homo sapiens
XP_517281	99.2	centrosome prot...	Pan troglodytes
EAX05478	99.9	hCG2027094 [Hom...	Homo sapiens
XP_001491802	90.5	centrosomal pro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13629	2.2e-07	23.8	KIAA0004
AB002376	6.3e-05	21.5	KIAA0378
AB007923	7.2e-05	22.8	KIAA0454
AB011140	0.00018	21.9	KIAA0568
AB051536	0.00025	21.2	KIAA1749

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	221	434	PD023692	NULL

Primer_f	TACACCACCCCTTAGTTCCAC
Primer_r	GAGGTAGAATTTGTGTCCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTAATAAAGACCTGGAGAAGC
Primer_r	TTCCAACTGCTGTGCTAACTG
PCR product length	143 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles