KIAA0568

Gene/Protein Characteristic Table for KIAA0568

Order Kazusa clone(s) from :

Product ID	ORK06451
Accession No	AB011140
Description	periplakin
Clone name	hh02280
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5143 bp) Predicted protein sequence (1426 aa)
Source	Human adult brain

Length: 5143 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Features of the protein sequence

Description

Length: 1426 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI14621	100.0	Periplakin [Hom...	Homo sapiens
O60437	99.9	Periplakin; 195...	Homo sapiens
NP_002696	99.9	periplakin [Hom...	Homo sapiens
AAC39668	99.8	periplakin [Hom...	Homo sapiens
AAC17738	99.8	195 kDa cornifi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	8.2e-07	23.2	KIAA0866
D13629	1.3e-05	21.1	KIAA0004
AB037740	0.00014	23.7	KIAA1319
AB023217	0.00019	21.3	KIAA1000
AB029004	0.0004	22.5	KIAA1081

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001101	1330	1362	PF00681	Plectin repeat
HMMSmart	IPR001101	1321	1355	SM00250	Plectin repeat
HMMSmart	IPR001101	1370	1405	SM00250	Plectin repeat

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	ACTGAAGGACAAGCCAACCAC
Primer_r	ATTCTCTGTAGGTGCCGGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACTGAAGGACAAGCCAACCAC
Primer_r	ATTCTCTGTAGGTGCCGGGAC
PCR product length	312 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp